Review




Structured Review

ReproCELL xav939 stemgent
Xav939 Stemgent, supplied by ReproCELL, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xav939+stemgent/pm38866017-578-81-82
Average 96 stars, based on 1 article reviews
xav939 stemgent - by Bioz Stars, 2026-09
96/100 stars

Images

Related Articles

Bicinchoninic Acid Protein Assay:

Article Title: Artificial extracellular matrix scaffolds of mobile molecules enhance maturation of human stem cell-derived neurons.
Article Snippet: In brief The utilization of iPSC technologies to model neurological diseases in vitro is challenging due to the inherent tendency of neurons to aggregate and their immature profile.. Kiskinis and colleagues developed artificial extracellular matrix biomimetic molecules exhibiting unprecedented molecular motion that promote advanced functional neuronal maturation and facilitate modeling of neurodegeneration.

Article Title: TNF-NF-κB-p53 axis restricts in vivo survival of hPSC-derived dopamine neurons.
Article Snippet: Article TNF-NF-kB-p53 axis restricts in vivo survival of hPSC-derived dopamine neurons

Cytotoxicity Assay:

Article Title: Artificial extracellular matrix scaffolds of mobile molecules enhance maturation of human stem cell-derived neurons.
Article Snippet: In brief The utilization of iPSC technologies to model neurological diseases in vitro is challenging due to the inherent tendency of neurons to aggregate and their immature profile.. Kiskinis and colleagues developed artificial extracellular matrix biomimetic molecules exhibiting unprecedented molecular motion that promote advanced functional neuronal maturation and facilitate modeling of neurodegeneration.

Reverse Transcription:

Article Title: Artificial extracellular matrix scaffolds of mobile molecules enhance maturation of human stem cell-derived neurons.
Article Snippet: In brief The utilization of iPSC technologies to model neurological diseases in vitro is challenging due to the inherent tendency of neurons to aggregate and their immature profile.. Kiskinis and colleagues developed artificial extracellular matrix biomimetic molecules exhibiting unprecedented molecular motion that promote advanced functional neuronal maturation and facilitate modeling of neurodegeneration.

Article Title: TNF-NF-κB-p53 axis restricts in vivo survival of hPSC-derived dopamine neurons.
Article Snippet: Article TNF-NF-kB-p53 axis restricts in vivo survival of hPSC-derived dopamine neurons

SYBR Green Assay:

Article Title: Artificial extracellular matrix scaffolds of mobile molecules enhance maturation of human stem cell-derived neurons.
Article Snippet: In brief The utilization of iPSC technologies to model neurological diseases in vitro is challenging due to the inherent tendency of neurons to aggregate and their immature profile.. Kiskinis and colleagues developed artificial extracellular matrix biomimetic molecules exhibiting unprecedented molecular motion that promote advanced functional neuronal maturation and facilitate modeling of neurodegeneration.

Multiplex sample analysis:

Article Title: Artificial extracellular matrix scaffolds of mobile molecules enhance maturation of human stem cell-derived neurons.
Article Snippet: In brief The utilization of iPSC technologies to model neurological diseases in vitro is challenging due to the inherent tendency of neurons to aggregate and their immature profile.. Kiskinis and colleagues developed artificial extracellular matrix biomimetic molecules exhibiting unprecedented molecular motion that promote advanced functional neuronal maturation and facilitate modeling of neurodegeneration.

other:

Article Title: Natural variation in gene expression and viral susceptibility revealed by neural progenitor cell villages.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Other Ultra-Low Attachment 96-well Round Bottom plate Corning Cat #7007 QIAmp DNA Blood Maxi kit Qiagen Cat #51192

Recombinant:

Article Title: TNF-NF-κB-p53 axis restricts in vivo survival of hPSC-derived dopamine neurons.
Article Snippet: Article TNF-NF-kB-p53 axis restricts in vivo survival of hPSC-derived dopamine neurons

Article Title: Molecular convergence between Down syndrome and fragile X syndrome identified using human pluripotent stem cell models.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Polyclonal Anti-FMRP Abcam Cat# ab17722; RRID: AB_2278530 Mouse Monoclonal Anti-GAPDH EMD Millipore Cat# MAB374; RRID: AB_2107445 Rabbi Monoclonal Anti-NCAM2 Abcam Ab173297 Rabbit Polyclonal Anti-DYRK1A Bethyl Laboratories Cat# A303-802A; RRID: AB_11218191 Rabbit Anti-FXR1P E. Khandjian ML-13 Rabbit Polyclonal Anti-CBS Proteintech Cat# 14787-1-AP; RRID: AB_2070970 Rabbit Monoclonal Anti-APP Abcam Cat# Ab32136; RRID: AB_2289606 Rabbit Monoclonal Anti-BACE2 Abcam Cat# Ab270458 Chemicals, peptides, and recombinant proteins SB431542 Tocris 1614 LDN-193189 Stemgent 04-0074 XAV939 Stemgent 04-0046 Critical commercial assays AllPrep DNA/RNA/miRNA Universal Kit Qiagen 80224 Deposited data RNA-seq This paper GEO: GSE144857; Github: https://www.ncbi.nlm.nih.gov/geo/ query/acc.cgi?acc=GSE144857 Experimental models: Cell lines Human: hESC H1 (NIH approval number NIHhESC-10-0043) Wicell H1 Human: UWWC1-DS1 WiCell UWWC1-DS1 Human: UWWC1-DS2U WiCell UWWC1-DS2U Human: UWWC1-2DS3 WiCell UWWC1-2DS3 Human: CW60278 CIRM Repository CW60278 Human: GM05131 Coriell FXS iPSC A Human: GM04026 Coriell FXS iPSC B Human: GM09497 Coriell FXS iPSC C Oligonucleotides FMR1 gRNA: GCGCTGCTGGGAACCGGCCG This paper G1 FMR1 gRNA: CAGGTCGCACTGCCTCGCGA This paper G2 FMR1 gRNA: AGACCAGACACCCCCTCCCG This paper G3 Recombinant DNA TetO-Ngn2-T2A-Puro Zhang et al., 2013 Addgene 52047 Software and algorithms CRISPR-ERA tool Liu et al., 2015 http://crispr-era.stanford.edu/ RNA-seq analysis This paper https://github.com/hbc/Molecular- convergence-between-Down-syndromeand-Fragile-X-syndrome-hPSCs https://doi.org/10.5281/zenodo.6974558 PRISM GraphPad N/A e1 Cell Reports 40, 111312, September 6, 2022 .. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Lindy E. Barrett (lbarrett@broadinstitute.org).

Laser Capture Microdissection:

Article Title: TNF-NF-κB-p53 axis restricts in vivo survival of hPSC-derived dopamine neurons.
Article Snippet: Article TNF-NF-kB-p53 axis restricts in vivo survival of hPSC-derived dopamine neurons

In Vivo:

Article Title: TNF-NF-κB-p53 axis restricts in vivo survival of hPSC-derived dopamine neurons.
Article Snippet: Article TNF-NF-kB-p53 axis restricts in vivo survival of hPSC-derived dopamine neurons

RNA Sequencing:

Article Title: Molecular convergence between Down syndrome and fragile X syndrome identified using human pluripotent stem cell models.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Polyclonal Anti-FMRP Abcam Cat# ab17722; RRID: AB_2278530 Mouse Monoclonal Anti-GAPDH EMD Millipore Cat# MAB374; RRID: AB_2107445 Rabbi Monoclonal Anti-NCAM2 Abcam Ab173297 Rabbit Polyclonal Anti-DYRK1A Bethyl Laboratories Cat# A303-802A; RRID: AB_11218191 Rabbit Anti-FXR1P E. Khandjian ML-13 Rabbit Polyclonal Anti-CBS Proteintech Cat# 14787-1-AP; RRID: AB_2070970 Rabbit Monoclonal Anti-APP Abcam Cat# Ab32136; RRID: AB_2289606 Rabbit Monoclonal Anti-BACE2 Abcam Cat# Ab270458 Chemicals, peptides, and recombinant proteins SB431542 Tocris 1614 LDN-193189 Stemgent 04-0074 XAV939 Stemgent 04-0046 Critical commercial assays AllPrep DNA/RNA/miRNA Universal Kit Qiagen 80224 Deposited data RNA-seq This paper GEO: GSE144857; Github: https://www.ncbi.nlm.nih.gov/geo/ query/acc.cgi?acc=GSE144857 Experimental models: Cell lines Human: hESC H1 (NIH approval number NIHhESC-10-0043) Wicell H1 Human: UWWC1-DS1 WiCell UWWC1-DS1 Human: UWWC1-DS2U WiCell UWWC1-DS2U Human: UWWC1-2DS3 WiCell UWWC1-2DS3 Human: CW60278 CIRM Repository CW60278 Human: GM05131 Coriell FXS iPSC A Human: GM04026 Coriell FXS iPSC B Human: GM09497 Coriell FXS iPSC C Oligonucleotides FMR1 gRNA: GCGCTGCTGGGAACCGGCCG This paper G1 FMR1 gRNA: CAGGTCGCACTGCCTCGCGA This paper G2 FMR1 gRNA: AGACCAGACACCCCCTCCCG This paper G3 Recombinant DNA TetO-Ngn2-T2A-Puro Zhang et al., 2013 Addgene 52047 Software and algorithms CRISPR-ERA tool Liu et al., 2015 http://crispr-era.stanford.edu/ RNA-seq analysis This paper https://github.com/hbc/Molecular- convergence-between-Down-syndromeand-Fragile-X-syndrome-hPSCs https://doi.org/10.5281/zenodo.6974558 PRISM GraphPad N/A e1 Cell Reports 40, 111312, September 6, 2022 .. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Lindy E. Barrett (lbarrett@broadinstitute.org).

Software:

Article Title: Molecular convergence between Down syndrome and fragile X syndrome identified using human pluripotent stem cell models.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Polyclonal Anti-FMRP Abcam Cat# ab17722; RRID: AB_2278530 Mouse Monoclonal Anti-GAPDH EMD Millipore Cat# MAB374; RRID: AB_2107445 Rabbi Monoclonal Anti-NCAM2 Abcam Ab173297 Rabbit Polyclonal Anti-DYRK1A Bethyl Laboratories Cat# A303-802A; RRID: AB_11218191 Rabbit Anti-FXR1P E. Khandjian ML-13 Rabbit Polyclonal Anti-CBS Proteintech Cat# 14787-1-AP; RRID: AB_2070970 Rabbit Monoclonal Anti-APP Abcam Cat# Ab32136; RRID: AB_2289606 Rabbit Monoclonal Anti-BACE2 Abcam Cat# Ab270458 Chemicals, peptides, and recombinant proteins SB431542 Tocris 1614 LDN-193189 Stemgent 04-0074 XAV939 Stemgent 04-0046 Critical commercial assays AllPrep DNA/RNA/miRNA Universal Kit Qiagen 80224 Deposited data RNA-seq This paper GEO: GSE144857; Github: https://www.ncbi.nlm.nih.gov/geo/ query/acc.cgi?acc=GSE144857 Experimental models: Cell lines Human: hESC H1 (NIH approval number NIHhESC-10-0043) Wicell H1 Human: UWWC1-DS1 WiCell UWWC1-DS1 Human: UWWC1-DS2U WiCell UWWC1-DS2U Human: UWWC1-2DS3 WiCell UWWC1-2DS3 Human: CW60278 CIRM Repository CW60278 Human: GM05131 Coriell FXS iPSC A Human: GM04026 Coriell FXS iPSC B Human: GM09497 Coriell FXS iPSC C Oligonucleotides FMR1 gRNA: GCGCTGCTGGGAACCGGCCG This paper G1 FMR1 gRNA: CAGGTCGCACTGCCTCGCGA This paper G2 FMR1 gRNA: AGACCAGACACCCCCTCCCG This paper G3 Recombinant DNA TetO-Ngn2-T2A-Puro Zhang et al., 2013 Addgene 52047 Software and algorithms CRISPR-ERA tool Liu et al., 2015 http://crispr-era.stanford.edu/ RNA-seq analysis This paper https://github.com/hbc/Molecular- convergence-between-Down-syndromeand-Fragile-X-syndrome-hPSCs https://doi.org/10.5281/zenodo.6974558 PRISM GraphPad N/A e1 Cell Reports 40, 111312, September 6, 2022 .. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Lindy E. Barrett (lbarrett@broadinstitute.org).

CRISPR:

Article Title: Molecular convergence between Down syndrome and fragile X syndrome identified using human pluripotent stem cell models.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Polyclonal Anti-FMRP Abcam Cat# ab17722; RRID: AB_2278530 Mouse Monoclonal Anti-GAPDH EMD Millipore Cat# MAB374; RRID: AB_2107445 Rabbi Monoclonal Anti-NCAM2 Abcam Ab173297 Rabbit Polyclonal Anti-DYRK1A Bethyl Laboratories Cat# A303-802A; RRID: AB_11218191 Rabbit Anti-FXR1P E. Khandjian ML-13 Rabbit Polyclonal Anti-CBS Proteintech Cat# 14787-1-AP; RRID: AB_2070970 Rabbit Monoclonal Anti-APP Abcam Cat# Ab32136; RRID: AB_2289606 Rabbit Monoclonal Anti-BACE2 Abcam Cat# Ab270458 Chemicals, peptides, and recombinant proteins SB431542 Tocris 1614 LDN-193189 Stemgent 04-0074 XAV939 Stemgent 04-0046 Critical commercial assays AllPrep DNA/RNA/miRNA Universal Kit Qiagen 80224 Deposited data RNA-seq This paper GEO: GSE144857; Github: https://www.ncbi.nlm.nih.gov/geo/ query/acc.cgi?acc=GSE144857 Experimental models: Cell lines Human: hESC H1 (NIH approval number NIHhESC-10-0043) Wicell H1 Human: UWWC1-DS1 WiCell UWWC1-DS1 Human: UWWC1-DS2U WiCell UWWC1-DS2U Human: UWWC1-2DS3 WiCell UWWC1-2DS3 Human: CW60278 CIRM Repository CW60278 Human: GM05131 Coriell FXS iPSC A Human: GM04026 Coriell FXS iPSC B Human: GM09497 Coriell FXS iPSC C Oligonucleotides FMR1 gRNA: GCGCTGCTGGGAACCGGCCG This paper G1 FMR1 gRNA: CAGGTCGCACTGCCTCGCGA This paper G2 FMR1 gRNA: AGACCAGACACCCCCTCCCG This paper G3 Recombinant DNA TetO-Ngn2-T2A-Puro Zhang et al., 2013 Addgene 52047 Software and algorithms CRISPR-ERA tool Liu et al., 2015 http://crispr-era.stanford.edu/ RNA-seq analysis This paper https://github.com/hbc/Molecular- convergence-between-Down-syndromeand-Fragile-X-syndrome-hPSCs https://doi.org/10.5281/zenodo.6974558 PRISM GraphPad N/A e1 Cell Reports 40, 111312, September 6, 2022 .. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Lindy E. Barrett (lbarrett@broadinstitute.org).

Magnetic Beads:

Article Title: Using brain cell-type-specific protein interactomes to interpret neurodevelopmental genetic signals in schizophrenia.
Article Snippet: ROCK Inhibitor (Y-27632) Stemgent Cat# 04-0012 SB 431542 Tocris Cat# 1614 StemFlex Medium Life Technologies Cat# A3349401 Microcentrifuge Tubes VWR International Cat# 0011-702 Sterile Sleeves VWR International Cat# 414004-510 Trizol Life Technologies Cat# 15596026 TruSeq Stranded Total RNA Library Prep Kit Illumina Cat# 20020596 .. XAV939 Stemgent Cat# 04-00046 Critical commercial assays Pierce Protein A/G Magnetic Beads Thermo Scientific Cat# 88803 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat# 34094 Pierce IP Lysis Buffer Thermo Scientific Cat# 87788 ..

Lysis:

Article Title: Using brain cell-type-specific protein interactomes to interpret neurodevelopmental genetic signals in schizophrenia.
Article Snippet: ROCK Inhibitor (Y-27632) Stemgent Cat# 04-0012 SB 431542 Tocris Cat# 1614 StemFlex Medium Life Technologies Cat# A3349401 Microcentrifuge Tubes VWR International Cat# 0011-702 Sterile Sleeves VWR International Cat# 414004-510 Trizol Life Technologies Cat# 15596026 TruSeq Stranded Total RNA Library Prep Kit Illumina Cat# 20020596 .. XAV939 Stemgent Cat# 04-00046 Critical commercial assays Pierce Protein A/G Magnetic Beads Thermo Scientific Cat# 88803 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat# 34094 Pierce IP Lysis Buffer Thermo Scientific Cat# 87788 ..



Similar Products

99
Worthington Biochemical 1974 dnase i worthington lk003170 sb431542 sigma aldrich s4317 xav939 stemgent
1974 Dnase I Worthington Lk003170 Sb431542 Sigma Aldrich S4317 Xav939 Stemgent, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xav939+stemgent/DNase+Vial/pm36459969-215-108-111
Average 99 stars, based on 1 article reviews
1974 dnase i worthington lk003170 sb431542 sigma aldrich s4317 xav939 stemgent - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

96
ReproCELL xav939 stemgent
Xav939 Stemgent, supplied by ReproCELL, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xav939+stemgent/pm38866017-578-81-82
Average 96 stars, based on 1 article reviews
xav939 stemgent - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
ReproCELL drug xav939 stemgent
Drug Xav939 Stemgent, supplied by ReproCELL, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xav939+stemgent/10__7554_slash_elife__80168-257-201-203
Average 96 stars, based on 1 article reviews
drug xav939 stemgent - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

97
R&D Systems 314 bp activina r d systems 338 ac 050 xav939 stemgent
314 Bp Activina R D Systems 338 Ac 050 Xav939 Stemgent, supplied by R&D Systems, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xav939+stemgent/Recombinant+Human+BMP-4+Protein/pm35325615-254-45-47
Average 97 stars, based on 1 article reviews
314 bp activina r d systems 338 ac 050 xav939 stemgent - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

Image Search Results